NEET 2024

169 Questions • 200 Minutes • 2024

Take This Paper Online

All Questions — Click to View Solution

Q121
Match List-I with List-II. [table] List-I (Types of stamen) | List-II (Example) ; (A) Monoadelphous | (I) Citrus ; (B) Diadelphous | (II) Pea ; (C) Polyadelphous | (III) Lily ; (D) Epiphyllous | (IV) China-rose [/table] Choose the correct answer from the options given below
View Answer & Solution
Q122
Read the following statements and choose the set of correct statements. In the members of Phaeophyceae. A. Asexual reproduction occurs usually by biflagellate zoospores. B. Sexual reproduction is by oogamous method only. C. Stored food is in the form of carbohydrates which is either mannitol or laminarin D. The major pigments found are chlorophyll a, c and carotenoids and xanthophyll. E. Vegetative cells have a cellulosic wall, usually covered on the outside by gelatinous coating of algin. Choose the correct answer front the options given below:
View Answer & Solution
Q123
Match List I with List II: [table] List I | List II ; A. Typhoid | I. Fungus ; B. Leishmaniasis | II. Nematode ; C. Ringworm | III. Protozoa ; D. Filariasis | IV. Bacteria [/table] Choose the correct answer from the options given below:
View Answer & Solution
Q124
Match List I with List II: [table] List I | List II ; A. Non-medicated IUD | I. Multiload 375 ; B. Copper releasing IUD | II. Progestonges ; C. Hormone releasing IUD | III. Lippes loop ; D. Implants | IV. LNG-20 [/table] Choose the correct answer from the options given below:
View Answer & Solution
Q125
Given below are two statements: Statement I: The presence or absence of hymen is not a reliable indicator of virginity. Statement II: The hymen is torn during the first coitus only. In the light of the above statements, choose the correct answer from the options given below:
View Answer & Solution
Q126
In both sexes of cockroach, a pair of jointed filamentous structures called anal cerci are present on:
View Answer & Solution
Q127
Match List I with List II: [table] List I | List II ; A. Pons | I. Provides additional space for Neurons, regulates posture and balance. ; B. Hypothalamus | II. Controls respiration and gastric secretions. ; C. Medulla | III. Connects different regions of the brain. ; D. Cerebellum | IV. Neuro secretory cells [/table] Choose the correct answer from the options given below:
View Answer & Solution
Q128
Which of the following is not a steroid hormone?
View Answer & Solution
Q129
Which one is the correct product of DNA dependent RNA polymerase to the given template? 3' TACATGGCAAATATCCATTCA5'
View Answer & Solution
Q130
Following are the stages of cell division: A. Gap 2 phase B. Cytokinesis C. Synthesis phase D. Karyokinesis E. Gap 1 phase Choose the correct sequence of stages from the options given below:
View Answer & Solution
Q131
Which of the following are Autoimmune disorders? A. Myasthenia gravis B. Rheumatoid arthritis C. Gout D. Muscular dystrophy E. Systemic Lupus Erythematosus (SLE) Choose the most appropriate answer from the options given below:
View Answer & Solution
Q132
Match List I with List II: [table] List I | List II ; A. Lipase | I. Peptide bond ; B. Nuclease | II. Ester bond ; C. Protease | III. Glycosidic bond ; D. Amylase | IV. Phosphodiester bond [/table] Choose the correct answer from the options given below:
View Answer & Solution
Q133
The flippers of the Penguins and Dolphins are the example of the
View Answer & Solution
Q134
Match List I with List II: [table] List I | List II ; A. Expiratory capacity | I. Expiratory reserve volume + Tidal volume + Inspiratory reserve volume ; B. Functional residual capacity | II. Tidal volume + Expiratory reserve volume ; C. Vital capacity | III. Tidal volume + Inspiratory reserve volume ; D. Inspiratory capacity | IV. Expiratory reserve volume + Residual volume [/table] Choose the correct answer from the options given below:
View Answer & Solution
Q135
Which one of the following factors will not affect the Hardy-Weinberg equilibrium?
View Answer & Solution
Q136
Given below are some stages of human evolution. Arrange them in correct sequence. (Past to Recent) A. Homo habilis B. Homo sapiens C. Homo neanderthalensis D. Homo erectus Choose the correct sequence of human evolution from the options given below:
View Answer & Solution
Q137
Following are the stages of pathway for conduction of an action potential through the heart: A. AV bundle B. Purkinje fibres C. AV node D. Bundle branches E. SA node Choose the correct sequence of pathway from the options given below:
View Answer & Solution
Q138
Which of the following factors are favourable for the formation of oxyhaemoglobin in alveoli?
View Answer & Solution
Q139
Match List I with List II: [table] List I | List II ; A. $\alpha$-1 antitrypsin | I. Cotton bollworm ; B. Cry IAb | II. ADA deficiency ; C. Cry IAc | III. Emphysema ; D. Enzyme replacement therapy | IV. Corn borer [/table] Choose the correct answer from the options given below:
View Answer & Solution
Q140
Given below are two statement: one is labelled as Assertion A and the other is labelled as Reason R: Assertion A: FSH acts upon ovarian follicles in female and Leydig cells in male. Reason R: Growing ovarian follicles secrete estrogen in female while interstitial cells secrete androgen in male human being. In the light of the above statements, choose the correct answer from the options given below:
View Answer & Solution
Paper Info
  • Exam: NEET
  • Year: 2024
  • Questions: 169
  • Duration: 200 mins
Take Online All Papers