NEET 2023

99 Questions • 180 Minutes • 2023

Take This Paper Online

All Questions — Click to View Solution

Q81
Which one of the following techniques does not serve the purpose of early diagnosis of a disease for its early treatment?
View Answer & Solution
Q82
Match List-I with List-II. [table] List-I (Interacting species) | List-II (Name of Interaction) ; A. A Leopard and a Lion in a forest/ grassland | I. Competition ; B. A Cuckoo laying egg in a Crow's nest | II. Brood parasitism ; C. Fungi and root of a higher plant in Mycorrtizae | III. Mutualism ; D. A cattle egret and a Cattle in a field | IV. Commensalism [/table] Choose the correct answer from the options given below:
View Answer & Solution
Q83
Which of the following statements is correct?
View Answer & Solution
Q84
Given below are two statements: Statement I: Electrostatic precipitator is most widely used in thermal power plant. Statement II: Electrostatic precipitator in thermal power plant removes ionising radiations In the light of the above statements, choose the most appropriate answer from the options given below:
View Answer & Solution
Q85
The unique mammalian characteristics are:
View Answer & Solution
Q86
Select the correct statements with reference to chordates. A. Presence of a mid-dorsal, solid and double nerve cord. B. Presence of closed circulatory system. C. Presence of paired pharyngeal gills D. Presence of dorsal heart E. Triploblastic pseudocoelomate animals. Choose the correct answer from the options given below:
View Answer & Solution
Q87
Which of the following is characteristic feature of cockroach regarding sexual dimorphism?
View Answer & Solution
Q88
Match List-I with List-II. [table] List-I | List-II ; A. Mast cells | I. Ciliated epithelium ; B. Inner surface of bronchiole | II. Areolar connective tissue ; C. Blood | III. Cuboidal epithelium ; D. Tubular parts of nephron | IV. specialised connective tissue [/table] Choose the correct answer from the options
View Answer & Solution
Q89
In cockroach, excretion is brought about by- A. Phallic gland B. Urecose gland C. Ncphrocytes D. Fat body E. Collatcrial glands Choose the correct answer from the options given below:
View Answer & Solution
Q90
Given below are two statements: Statement I: During G$_0$ phase of cell cycle the cell is metabolically inactive Statement II: The centrosome undergoes duplication during S phase of interphase. In the light of the above statements, choose the most appropriate answer from the option below:
View Answer & Solution
Q91
Select the correct statements. A. Tetrad formation is seen during leptotene B. During Anaphase, the centromere split and chromatids separate. C. Terminalization takes place during Pachytene. D. Nucleolus, Golgi complex and ER are reformed during Telophase. E. Crossing over takes place between sister chromatids of homologous Choose the correct answer from the option given below:
View Answer & Solution
Q92
Which of the following statements are correct? A. Basophils are most aboundant cell of the total WBCs B. Basophils secrete histamine, serotonin and heparin C. Basophils are involved in inflammatory response D. Basophils have kidney shaped nucleus E. Basophil are agranulocyte Choose the correct answer from the options given below:
View Answer & Solution
Q93
Which of the following statements are correct? A. An excessive loss of body fluid from the body switches off osmoreceptors. B. ADH facilitates water reabsorption to prevent diuresis. C. ANF causes vasodilation. D. ADH causes increase in blood pressure. E. ADH is responsible for decrease in GFR. Choose the correct answer from the options given below:
View Answer & Solution
Q94
Which of the following statements are correct regarding skeletal muscle? A. Muscle bundles are held together by collagenous connective tissue layer called fascicle. B. Sarcoplasmic reticulum of muscle fibre is a store house of calcium ions. C. Striated appearance of skeletal muscle fibre is due to distribution pattern of actin and myosin proteins. D. M line is considered as functional unit of contraction called sarcomere. Choose the most appropriate answer from the options given below:
View Answer & Solution
Q95
The parts of human brain that helps in regulation of sexual behaviour, expression of excitement, pleasure, rage, fear etc. are.
View Answer & Solution
Q96
Which of the following are NOT under the control of thyroid hormone? A. Maintenance of water and electrolyte balance B. Regulation of basal metabolic rate C. Normal rhythm of sleep-wake cycle D. Development of immune system E. Support the process of R.B.Cs formation Choose the correct answer from the options given below:
View Answer & Solution
Q97
Which one of the following is the sequence on corresponding coding strand, if the sequence on mRNA formed is as follow 5’AUCGAUCGAUCGAUCGAUCGAUCGAUCG 3’?
View Answer & Solution
Q98
Which one of the following NOT an advantage of inbreeding?
View Answer & Solution
Q99
Match List-I with List-II. [table] List-I | List-II ; A. Logistic growth | I. Unlimited resource availability condition ; B. Exponential growth | II. Limited resource availability condition ; C. Expanding age pyramid | III. The percent individuals of pre-reproductive age is largest followed by reproductive and post reproductive age groups ; D. Stable age pyramid | IV. The percent individuals of pre-reproductives and reproductive age group are same [/table] Choose the correct answer from the options given below:
View Answer & Solution
Paper Info
  • Exam: NEET
  • Year: 2023
  • Questions: 99
  • Duration: 180 mins
Take Online All Papers